Filtyp
Lägg till titel FÖRSÄTTSSIDA STYRDOKUMENT Kvalitetspolicy för Lunds universitet Typ av styrdokument: Policy Definition av typen av styrdokument: En policy uttrycker ledningens övergripande viljeriktning eller värden som ska beaktas inom det område policyn omfattar och sätter ramarna för ett visst handlande och utgör en stark rekommendation om ett visst handlingssätt. Beslutsfattare: Universitetsst
Lägg till titel FÖRSÄTTSSIDA STYRDOKUMENT Kvalitetspolicy för Lunds universitet Typ av styrdokument: Policy Definition av typen av styrdokument: En policy uttrycker ledningens övergripande viljeriktning eller värden som ska beaktas inom det område policyn omfattar och sätter ramarna för ett visst handlande och utgör en stark rekommendation om ett visst handlingssätt. Beslutsfattare: Universitetsst
Moraxella catarrhalis is a human-specific commensal of the respiratory tract and an opportunistic pathogen. It is one of the leading cause of otitis media in children and of acute exacerbations in patients with chronic obstructive pulmonary disease, resulting in significant morbidity and economic burden. Vaccines and new immunotherapeutic strategies to treat this emerging pathogen are needed. Comp
Background – Advancing the development of highly efficacious and long-lasting malaria vaccines is hampered by incomplete knowledge of protective immune mechanisms and an absence of established correlates of immunity. Antibody avidity is frequently evaluated as an indicator of a high-quality or protective antibody response to vaccination. However, the importance of avidity in vaccine-induced immuni
Öresundsregionen växer och i takt med en ökad befolkning och nyetablerade industrier blir behovet av el allt större. Samtidigt som elbehovet ökar är elnätet bristande och med en kärnkraft som håller på att avvecklas hotas områden i södra Sverige av elbrist. För att kunna möta de framtida utmaningar som samhället står inför har Malmö Stad inlett ett projektsamarbete vid namn M21 tillsammans med närThe Öresund region is expanding with a growing population and newly established industries which leads to an increased demand of electricity. At the same time as the demand of electricity is increasing there is are deficiencies in the power grid and a dismantling of nuclear power which creates a situation where parts of southern Sweden are threatened by power shortage. In order to prepare for futu
Streptococcus pyogenes is an exclusively human pathogen that can provoke mild skin and throat infections but can also cause fatal septicemia. This gram-positive bacterium has developed several strategies to evade the human immune system, enabling S. pyogenes to survive in the host. These strategies include recruiting several human plasma proteins, such as the complement inhibitor, C4b-binding prot
Centre for Innovation Research – CIRCLE – is an interdisciplinary centre which connects innovation researchers from different faculties at Lund University as well as other Swedish and international universities. The meaning of the term innovation has transformed and is now tightly linked to sustainable development goals including climate change, social sustainability and food security. CIRCLE’s aCentre for Innovation Research – CIRCLE – is an interdisciplinary centre which connects innovation researchers from different faculties at Lund University as well as other Swedish and international universities. The meaning of the term innovation has transformed and is now tightly linked to sustainable development goals including climate change, social sustainability and food security. CIRCLE’s a
Ordförandebrev 210328 Information om nytt RALS-avtal vid GU/ Local collective agreement for salary revision in place Please see English version below. Hej! Nu har vi ett nytt RALS-avtal (RAmavtal för Lönesättning i Staten) på plats och därmed kan lönerevisionen gå in i slutfasen och därefter kan de nya lönerna utbetalas. Vi är överens med arbetsgivaren om att detta bör vara klart före sommaren. År
Sagem Défense et Sécurité (now Safran Electronics & Defense), a French space and defense company of the SAFRAN group, is working on the next generation of Unmanned Aerial System (UAS). This UAS features a fully automatic Unmanned Aerial Vehicle (UAV) equipped with a state-of-the-art navigation system. This navigation system relies mainly on a high-accuracy Inertial Measurement Unit (IMU) coupl
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
FVP 2026.indd Verksamhetsplan 2026 GEMENSAMMA FÖRVALTNINGEN | LUNDS UNIVERSITET GEMENSAMMA FÖRVALTNINGENS VERKSAMHETSPLAN 2026 © Lunds universitet 2026 www.lu.se lu@lu.se TRYCK Media-Tryck, LU Service, Lunds universitet www.mediatryck.lu.se media-tryck@service.lu.se Svanenmärkt trycksak, 341903 PROJEKTLEDARE Susanne Hägerström, Utveckling FORMGIVNING Stefan Andersson, LU Service TEXTBEARBETNING Su
A dinuclear manganese complex {[(Mn2L)-L-II,IIII(mu-OAc)(2)]-ClO4} has been synthesised, where L is the dianion of 2-{[bis-(pyrid-2-ylmethyl)amino]methyl}-6-{[(3,5-di-tert-butyl-2- hydroxybenzyl)(pyrid-2-ylmethyl)amino]methyl)-4-methylphenol, an unsymmetric binucleating ligand with two coordinating phenol groups. The two manganese ions, with a Mn-Mn distance of 3.498 angstrom, are bridged by the t
