Search results

Introduction: In Sierra Leone, West Africa, there are many people with disabilities in need of rehabilitation services after a long civil war. Sierra Leone is among the ten least developed countries in the world and half of the population live under the absolute poverty line with an income less than $1.25 a day. Aim: The aim of this qualitative study was to explore the experiences of prosthetic an

BACKGROUND: Malignant melanoma is the most deadly form of skin cancer. Female sex is known to have a protective effect on incidence, tumour characteristics, and mortality from melanoma. However, the potentially modifying effect of sex on the prognostic significance of clinicopathological and investigative factors is generally not taken into consideration in biomarker studies. In this study, we com

N-acylated substituted β 3 oligoamides are known to form unique supramolecular nanorods based on a 3-point hydrogen bond self-assembly motif. This motif is an intermolecular extension of the hydrogen bonding network that stabilizes the 14-helix secondary structure unique to β 3 oligoamides. Acetylation of the N-terminus of the molecule provides the necessary third hydrogen bond pair of the motif.

Cryptosystems based on the learning with errors (LWE) problem are assigned a security level that relates to the cost of generic algorithms for solving the LWE problem. This includes at least the so-called primal and dual lattice attacks. In this paper, we present an improvement of the dual lattice attack using an idea that can be traced back to work by Bleichenbacher. We present an improved distin

Denna avhandling behandlar spridning av lätta mesoner i fallet där antalet externa mesoner överstiger fyra (d.v.s. tre eller fler partiklar i initial- eller finaltillståndet), beräknat genom kiral störningsräkning. Detta är både av teoretiskt intresse inom studien av spridningsamplituder, och relevant för system av tre eller fler pioner som simuleras genom gitter-kvantkromodynamik.Introduktionen hThis thesis concerns scattering of light mesons in the case where the number of external particles exceeds four (that is, three or more particles in the initial or final state), calculated using chiral perturbation theory.This is both of theoretical interest in the study of scattering amplitudes, and relevant for systems of three or more pions simulated using lattice quantum chromodynamics.The int

Purpose: The sugar industry is always pressured to be suitable and enhance its operational effectiveness. Digital Twin (DT) has the potential to transform this industry. However, the lack of industry-specific Key Performance Indicator (KPI) frameworks makes it challenging to implement them. This study provides a hierarchical KPI model for DT adoption in the sugar sector, interconnecting the United

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Øresund EcoMobility contributes to knowledge creation for sustainable transport and green logistics, city transport, and energy systems with a specific focus on the conditions and needs of the Øresund region. In this book, long distance goods transport and strategies for green corridors through the Øresund and Europe are studied, multi-criteria models for analysis in transport and infrastructural

Utvecklingsenheten Postadress Campus Helsingborg Box 882, 251 08 Helsingborg Besöksadress Universitetsplatsen 2, 252 25 Helsingborg Telefon, 042-35 65 19, 042- 35 65 00 (växel) E-post carola.fors@ch.lu.se Webbadress www.ch.lu.se 1 (7) Minnesanteckningar, Campusgruppsmöte 7 februari 2024 Närvarande: Charlotta Johnsson Rektor, Utvecklingsenheten Jerker Jacobsson Utvecklingsenheten Julia Luttrup Utve

https://www.ch.lu.se/internt/sites/ch.lu.se.internt/files/2024-02/Campusgruppen%202024-02-07%20minnesant..pdf - 2026-06-03

1 2018 BECC Gothenburg Ambec, S., & Coria, J. (2018). Policy spillovers in the regulation of multiple pollutants. Journal of Environmental Economics and Management, 87, 114-134. doi:https://doi.org/10.1016/j.jeem.2017.05.011 Andersson-Sköld, Y., Klingberg, J., Gunnarsson, B., Cullinane, K., Gustafsson, I., Hedblom, M., . . . Thorsson, S. (2018). A framework for assessing urban greenery's effects a

https://www.becc.lu.se/sites/becc.lu.se/files/2016-2018_becc_gu_publikationer_0.pdf - 2026-06-03

Mästers manuskript AKADEMITRÄDGÅRDSMÄSTARE GERNANDTS ”REGLOR FÖR TRÄDGÅRDSKONSTEN” FRÅN 1837 I LJUSET AV UNIVERSITETSBIBLIOTEKETS SAMLINGAR Utställning på Universitetsbiblioteket 8/12 2016 – 29/4 2017 Akademiträdgårdsmästaren Johannes Gernandt (1769-1850) fick aldrig se sina Reglor för trädgårds- konsten utgivna. Inte förrän nu, nästan 200 år senare, finns de för första gången tillgängliga för all

https://www.ub.lu.se/en/sites/ub.lu.se.en/files/utstallningskatalog_webb.pdf - 2026-06-03

Handbok för anställda InstItutIonen för psykologI Postadress Institutionen för psykologi Box 213 221 00 LUND Postadress till specifik person (extern post) Lunds Universitet Institutionen för Psykologi Förnamn Efternamn Paradisgatan 5P 223 50 Lund Besöksadress Allhelgona Kyrkogata 14 O, 14 M och Paradisgatan 5 P 223 50 Lund Telefax 046-222 42 09 Internpost Hämtställe 31 Kostnadsställe 253099 Webbsi

https://www.psy.lu.se/en/sites/psy.lu.se.en/files/handbok_webb.pdf - 2026-06-03

PROGRAM VT 2022 ODEUM LUNDS UNIVERSITETS MUSIKCENTRUM TEMA: NATURSKILDRINGAR Välkomna till vårens evenemangsserie vid Odeum, fylld av konserter, gästspel och samtal om musik! Temat för våren är Naturskildringar. Ett brett tema där vi inte minst vill lyfta fram de pågående klimatförändringarna och vad dessa för med sig för skapande musiker och tonsättare. Några av de svenska tonsättare som skrivit

https://www.odeum.lu.se/en/sites/odeum.lu.se.en/files/2022-03/ODEUM_programbok_VT_2022.pdf - 2026-06-03

Page 1 of 10 PhD Administration General syllabus for third-cycle studies in Industrial Environmental Economics TEMIMF00 The syllabus was approved by the Board of the Faculty of Engineering/LTH 24 September 2007 and most recently amended 24 June 2021 (reg. no U 2021/419). 1. Subject description The aim of Industrial Environmental Economics is to provide knowledge of strategies, policies and tools t

https://www.iiiee.lu.se/internal/sites/iiiee.lu.se.internal/files/2021-06/ASP%20Industriell%20milj%C3%B6ekonomi%20(eng)%20-%20U%202021_419.pdf - 2026-06-03

Cities affected by the impacts of climate change have to find new ways to adapt to the variability in weather patterns, such as heavy rainfalls and storms. The coastal city Malmö, a former industrial city, aims to be carbon neutral by 2020 and provided by 100 percent renewable energies in 2030. However, Malmö is facing many environmental and socio-economic challenges. One of these challenges is to

Med ett politiskt parti anklagat för fascism i riksdagen, och nynazister marscherande på gatorna är frågor om demokrati och frihet viktigare än någonsin. Var bör yttrandefrihetens gränser dras? Bör den överhuvudtaget begränsas? Syftet med den här uppsatsen är att utforska en möjlig lösning till de problem som dagens demokrati står inför. Det här åstadkoms genom en konstruktion av ett konceptuellt With a political party accused of fascism in the Swedish parliament and neo-nazis marching in the streets, questions of democracy and freedom of expression are as important as ever. Where to draw the boundaries of the freedom of expression? Why have, or limit, such freedoms in the first place? The purpose of this thesis is to investigate a possible solution to the problems facing contemporary demo

Alltsedan incitamentsprogrammen introducerades i Sverige med inspiration från USA i mitten på 1900-talet har beskattningen av dem orsakat såväl tillämpningsproblem som debatt. Det handlar om de situationer där ett företag erbjuder anställda aktier i bolaget antingen i form av värdepapper eller personaloptioner. Den förra medför en rättighet direkt, medan den senare innebär en framtida rätt under fSince incentive plans first arrived to Sweden with inspiration from the U.S. in the middle of the 20th century the taxation of the programs have caused application problems as well as debate. The issue concerns situations where an employee is offered shares in the company based on securities or stock options. The employee hopes that he or she will get a piece of the profit in the future, while the

De senaste åren har den svenska sockerkonsumtionen debatterats flitigt i media. Att Sverige skulle införa en sockerskatt för att minska den höga konsumtionen har föreslagits av såväl akademiker som politiker. Trots att ett införande av en svensk sockerskatt har föreslagits i en rad riksdagsmotioner, har dessa avslagits gång på gång. Debatten har trots detta fortsatt, och att den till slut kommer uIn the past few years the high sugar consumption has been a concern in Sweden as well as world wide because of the health problems it may lead to. As a result of the increased sugar consumption, some countries have introduced a tax on sugar to reduce the consumption. In Sweden there is an ongoing debate concerning a possible introduction of this kind of tax, but the Swedish tax committee has rejec

Docent | Universitetslektor | Meriterad lärare Kontaktinformation E-post: malena [dot] rosen_sundstrom [at] svet [dot] lu [dot] se Telefon: +46 46 222 49 94Organisation Statsvetenskapliga institutionen Rumsnummer: 357 Hämtställe: 31 WebbplatsMalena Rosén Sundströms profil i Lunds universitets forskningsportalAndra roller Universitetslektor Statsvetenskapliga institutionenStatsvetenskapFrämsta fors

https://www.svet.lu.se/malena-rosen-sundstrom - 2026-06-03

Senior lecturer Contact details Email: lisa [dot] engstrom [at] kultur [dot] lu [dot] se Phone: +46 46 222 04 58Organisation Information Studies Visiting address: Helgonavägen 3, Lund Room number: LUX:C451 Service point: 30 WebpageLisa Engströms profile in Lund University research portalOther affiliations Profile area member LU Profile Area: Human rights Associate professor Information Studies Aff

https://www.humanrights.lu.se/lisa-engstrom - 2026-06-03